DONATE

Showing posts with label VAERS Data. Show all posts
Showing posts with label VAERS Data. Show all posts

Monday, February 28, 2022

Actual Science of mRNA Deaths & DNA Alterations

 


John R. Houk, Blog Editor

© February 28, 2022

 

I am not actually a science-oriented person. HOWEVER, I can read. Today I am sharing info from science oriented people. If you can refute the data with a science rebuttal that is not a simple fake Globalist-science admonition of “fake,” “false” – without the reason, “misinformation” by telling why without character assassination, and YOU GET THE IDEA; then I’d love to read the scientific refutation. If you cannot, I’ll just call you a Left-Wing lying propagandist trying to maintain Globalist-Marxist control of the population via fearmongering.

 

The first cross post is explanatory from the title: “Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years.”

 

The next two cross posts are related to the science-deep reporting of Igor Chudov on Substack. Those posts are full of links and diagrams to actual scientific studies that stretches my mind to comprehend but Chudov makes the effort to make the science comprehensible.

 

FIRST Chudov article: I’m using the NWO Report version because it’s simply easier to read than the Substack version was posted on 2/25/22: “Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA.”

 

SECOND Chudov article: Is from his Substack page: “DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene.”

 

JRH 2/28/22

I need your generosity. PLEASE GIVE to overcome research expenses:

Please Support SlantRight 2.0

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**************************

Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years

 

By Brian Shilhavy Editor, Health Impact News

February 26, 2022

Vaccine Impact

 

 

Comparison VAERS Vaxx Data

 

The latest data dump into the U.S. Government’s Vaccine Adverse Events Reporting System (VAERS) happened yesterday (2/25/21) and covers data through 2/18/2022.

 

This data is supplied by the FDA and the CDC.

 

Since December of 2020, when the COVID-19 vaccines were issued emergency use authorization, there are now a recorded 1,134,984 cases of deaths and injuries.

 

 

1-Year-Data-Covid19-Vaccines

Source.

 

There are now more reported cases of injuries and deaths following COVID-19 vaccines for the past year than there were following all vaccines for the previous 30 years before the COVID-19 vaccines were authorized.

 

 

30+ Years Data Cases VAERS

Source.

 

And there are now almost twice as many deaths recorded following COVID-19 vaccines in its first year than there were recorded in the previous 30 years before the COVID-19 vaccines were introduced.

 

Why are we still doing this?

 

Here is the CDC’s response after publishing this data:

 

CDC (DECEPTIVE) response to Data

 

Comment on this article at HealthImpactNews.com.

See Also:

 

Rumble VIDEO: In Memoriam: Victims of COVID-19 "Vaccines"

[Posted by HealthImpactNews

Published August 2, 2021

 

There are no second chances after you take the shot(s) and your family and friends mourn you at your funeral.]

 

MORE Information on Page TO READ

 

Copyright 2022 Health Impact News 

Vaccine Impact HOME PAGE

 

+++++++++++++++++++++

Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA

 

 

Pfizer Jab

 

Posted by Nwo Report

Source: Igor Chudov

February 27, 2022

NWO Report

 

For over a year, our trusted “health experts and fact checkers” have been telling us that mRNA vaccines, including Pfizer and Moderna, do not integrate themselves into human cellular DNA. However, a bombshell new study published in Current Issues of Molecular Biology shows that the health experts and fact checkers were wrong.

 

Lab studies show that mRNA vaccines DO integrate themselves into human cellular DNA. In essence, the vaccines change your DNA forever.

 

 

Intracellular Reverse Transcription Pfizer

 

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

 

Mainstream media and fact checkers have dedicated themselves to telling us the opposite:

 

MSM Disinformation Lies

 

However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.

 

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

 

 

IgorChudov reports:

 

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

 

However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

 

Molecular Biology Abstract screen capture

 

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.

 

It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).

 

What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.

 

This process is called “transcription”.

 

For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.

 

To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.

 

Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

 

 

Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme

 

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

 

 

Transcribed DNA Seen NOT RNA

 

The genetic code that they picked up is:

 

Ø CGAGGTGGCCAAGAATCTGAACGAGA

 

Ø GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA

 

Ø TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT

 

Ø GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT

 

Ø TCGACGAGGACGATTCTGAGCCCGTGCTGA

 

Ø AGGGCGTGAAACTGCACTACACATGATGAC

 

Ø TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA

 

Ø GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT

 

Ø CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

 

Anyone wants to run BLAST on it?

 

Simplified

 

As I explained in response to a questioner:

 

Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.

 

Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.

 

Cancer Code

 

Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.

 

Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.

 

Please repost this article far and wide due to its big implication for our public health.

 

EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?

 

 

mRNA and S Protein data

 

© 2022 NWO REPORT

 

++++++++++++++++++++

DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene

Having fun BLASTing DNA Reverse Transcribed from Pfizer Vax

 

By Igor Chudov

2/27/22

Igor’s Newsletter

 

My previous post about a science article proving that Pfizer mRNA vaccine reverse transcribes into human DNA, has garnered enormous interest and lots of comments, may of which were incredible.

 

If you did not read it yet, PLEASE READ IT FIRST before reading this article. Otherwise you may get lost and not even realize the significance of how your loved ones’ genetic code may have been reprogrammed. Here you go:

 

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?utm_source=substack&utm_campaign=post_embed&utm_medium=web

 

I decided to continue plodding along and see what else we can uncover, based on that “Current Issues in Molecular Biology” article:

 

 

Igor Newsletter- Reverse Transcription

 

The article contains a printout of genetic DNA code that was detected in human cell DNA materials reverse transcribed from the mRNA vaccine.

 

 

printout of genetic DNA code 

 

So, I decided to check what is actually in this code above, is that just harmless junk or something more ominous. For that, I ran a free NCBI “BLAST” tool by copying and pasting the above genetic sequence in it. This is the same BLAST tool that @JikkyKjj used to show a Moderna “cancer patent” sequence on the most important, “furin cleavage site” of Sars-Cov-2. I wrote about that also:

 

https://igorchudov.substack.com/p/moderna-patented-cancer-gene-is-in?utm_source=substack&utm_campaign=post_embed&utm_medium=web

 

Anyway, impressed with @JikkyKjj’s discovery, I decided to do the same with the DNA code that Pfizer mRNA vaccine generates (reverse transcribes) into human cells. Turns out that I was the first to enter that sequence into the NCBI BLAST tool (because it took a while to analyze) and it now has a sequence ID of 1R3ZDZJY016.

 

And here are the results. I annotated them to make it easier for you to see what is and is not interesting.

 

 

Igor Annotations

 

The first few results are from the usual suspects such as chimeric viruses, Sars-Cov-2 sequences, etc. It is understandable why we should ignore them — the chimeric viruses are pure lab constructs of unknown significance, and Sars-Cov-2 sequences are obviously there because the vaccine encodes Sars-Cov-2 spike protein. Those are “expected matches”.

 

What is interesting — and I am not saying it is the only thing — is the gp130 glycoprotein gene that is 97% similar to the human gp130 glycoprotein gene. The chance of that being a random coincidence, per BLAST tool, is 0.000000000000000000000000000000000000000000000000000000000002.

 

I clicked on it:

 

 

Red Dots Show gp130 Mutations

 

You can click on the “Gene” link to see what that gp130 gene is about:

 

 

TLE family member 5

 

 

here this gene is used

 

So, we have Pfizer Covid mRNA vaccine reverse transcribe to a MUTATED gp130 gene. Remember the 97% match? The 3% non-matches, the four red dots, are the mutations of the gp130 gene.

 

So, without looking at these specific mutations, what happens when gp130 gene mutates in general? Nothing good comes up and you can search for it too.

 

 

Liver Cancer focus

 

Please note that a question arises: gp130 mutations can cause liver tumor, and the entire experiment was performed on a line of immortal liver cancer cells. Could it be that the original article picked up mutated gp130 from the Huh7 liver cancer cells? If that is the case, if the DNA sequence is inherent to Huh7 line itself, it could invalidate a lot of conclusions that the original science article, as well as my own articles, were making.

 

However, the authors were diligent with controls and did NOT see the questioned DNA sequence that I am looking at, in the control cells that did NOT receive the Pfizer vaccine. In addition, the published DNA sequence contained Sars-Cov-2 genes (see BLAST results), so it does come from the effect of the vaccine, not the Huh7 culture cells.

 

No DNA in Controls

 

I did perform some cursory checks, to the best of my ability, and the Huh7 line contains p53 mutations, but it does not seem like it contains gp130 mutations.

 

So, keeping my fingers crossed, the mutated gp130 gene that I found, is a genuine finding of lab research, comes from the mRNA vaccine, and not a coincidental pickup from the Huh7 cells.

 

I am guessing that the authors were looking at liver cells specifically, because they knew where to look (that the mRNA delivery system delivers the lipid nanoparticles to the liver). Why did the authors pick liver cells? Maybe because they heard of this 4chan post from 2020, when NOTHING yet was known about the strange mRNA vaccines:

 

mRNA Mostly Ends Up in Liver

 

[Blog Editor: I’ve noticed Nwo Report authors have spliced some of the photo arrays from this point in their post above. If you choose to read it at the Igor Newsletter Substack go HERE.]

 

© 2022 Igor Chudov