DONATE

Showing posts with label Igor Chudov. Show all posts
Showing posts with label Igor Chudov. Show all posts

Sunday, December 24, 2023

Medical Tyranny: What’s the mRNA-DNA Intention?

YOU NEED TO ASK YOURSELF, 'WHY?'!


John R. Houk, Blog Editor

December 24, 2022

 

WELL… It appears holiday distractions has caught up to me this week. I’ve found these posts to share at least a couple of days ago, but you might night see them until 12/24/23.

 

Today’s post is a return to examining the Medical Tyranny being perpetrated on Americans (really the entire world) with the full cooperation of a lying government and a lying Big Pharma (whose nefarious goals probably range from greed to Globalist-Elitist population control or combinations of both).

 

First up is an Igor Chudov (Substack) post showing that DNA is indeed affected if not downright altered by mRNA gene therapy Jabs (H/T Vigilant News). Yup, all those so-called scientists and/or doctors crying misinformation/disinformation Conspiracy Theory against those exposing DNA adulteration are in fact the liars (at worst) or the gullible-deluded (at best) spreaders of misinformation/disinformation.

 

THEN NEXT a post I discovered on 12/24 morning from Telegram Natural News entitled, “Bill Gates organization partners with biotech company to develop needle-free mRNA vaccine WAFER for taking under the tongue”.

 

NEXT up is a Lioness of Judah Ministry (Substack) who cross posts from The Exposé the self-explanatory title, “FRIGHTENING TRUTH: Airborne mRNA Vaccines Are Being Created That Can Be Delivered Straight Into the Lungs Without the Need for Injection”. After reading Chudov’s post on mRNA Jabs altering DNA, YOU should ask yourself, “Why would lying governments and deceptive Big Pharma want to massively dose populations with gene altering mRNA?

 

AND FINALLY a Lee Hall-Dr. Robert Malone interview via EPOCH TV’s British Thought Leaders (I’ll upload to my Bitchute & UGETube channel for sharing purposes) originally posted 12/21/23. The title: “Dr Robert Malone: ‘I’ve Been Labelled an Enemy of the State for Speaking Inconvenient Truths’ | British Thought Leaders”.

 

JRH 12/24/23

READER SUPPORTED!

PLEASE! I need more Patriots to step up. I need Readers willing to chip in $5 - $10 - $25 - $50 - $100. PLEASE YOUR generosity is NEEDED. PLEASE GIVE to Help me be a voice for Liberty:

Please Support SlantRight 2.0

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

************************

COVID Vaccines Integrate Into Human DNA, Study Finds:

The much-ridiculed "antivax trope" proved to be true

 

By IGOR CHUDOV

December 21, 2023

Igor’s Newsletter

 

Summary: a study of humans suffering from Long Covid analyzed their cellular DNA. The authors unexpectedly found genes uniquely specific to the Pfizer COVID vaccine in human blood cells. This finding proves that mRNA COVID vaccines permanently integrate into the DNA of some COVID-vaccinated people.

 

newly published study analyzed human DNA isolated from volunteers' blood samples. Authors looked for matches between blood cells’s DNA and genetic sequences unique to the Pfizer COVID vaccine BNT162b2. After using sensitive tests, scientists found genes that could only come from the Pfizer COVID vaccine in the genomes of blood samples analyzed.

 

Long COVID DNA Discovery

 

What is this about?

 

Almost two years ago, I posted a description of a study that found integration of Pfizer’s COVID vaccine into human DNA, discovered by a lab experiment in a dish (in-vitro).

 

Worst Fears Realized: Pfizer mRNA Transcribes into DNA

mRNA Vaccines Actually are "Gene Therapy", Study Shows

 

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line. What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cellsREAD MORE (2/25/22)

 

Experiments involving human cells in Petri dishes are easier and lead to easily reproducible results. However, there is always a question of whether the results of such experiments on cell cultures can be replicated in live human beings.

 

Specifically, does the COVID-19 vaccine reverse transcribe, integrate, and thus become part of human DNA in living, breathing humans? We had no answer to that question - until now.

Spoiler alert - the answer is yes - the mRNA Covid vaccine sometimes becomes a part of DNA.

 

The study by Dhuli et al. describes an interesting scientific discovery journey by Italian scientists exploring the so-called “Long Covid.”

 

At first, they detected spike protein, with certain features specific to Covid vaccines only, in the blood of some people suffering from Long Covid.

 

Discussions- Viral-Vaxx Spike Protein Presence

 

The detection happened long after vaccination.

 

mRNA Post-Jab Discovery

 

Then, the study authors asked, how is long-term spike protein production possible? Could it be due to DNA changes making their cells into permanent spike-protein factories?

 

To answer that question, they used DNA-specific tests to detect the presence of COVID vaccine genetic code in the genomes of the cells of study subjects.

 

The supplement explains:

 

COVID vaccine genetic code in the genomes of the cells

 

Did the scientists find anything interesting in these genomes?

 

The answer is yes - some experimental subjects’ DNA was altered and contained genes that could only come from the Pfizer COVID vaccine!

 

Supplementary Discussion - DNA was altered

 

Authors note, above, that their findings are consistent with ‘intracellular reverse transcription’ - the vaccine becoming part of the genomes of its recipients!

Pfizer genetic code was detected in cellular DNA

 

The image points out that it was the cellular DNA where the Pfizer genetic code was detected, not RNA or proteins.

 

Words of Caution

 

The above findings are unsettling and show that some vaccinated people experience forced alteration of their genomes, with spike protein-producing code permanently residing in the affected cells.

 

However, we do not know how many cells are affected in persons experiencing reverse transcription and integration of Pfizer vaccine code into their DNA. The methods used to detect such altered genetic strands are very sensitive. I hope the Pfizer vaccine-code-carrying cells are a small minority in each affected organism.

 

We also do not know if reproductive cells (eggs and sperm) are affected. Are there any newborns whose germ-line genes carry the Pfizer vaccine code? (check out this post by the Daily Beagle also)

 

Further, it appears that not every vaccinated person was affected by this reverse integration, and therefore, vaccinated individuals have hope that they were not the ones whose genomes were altered.

 

Additionally, the journal where this study was published is not the most prestigious. (Prestigious journals do not like to publish scientific findings critical of COVID vaccines.) I hope more studies will attempt to reproduce the authors’ methods to confirm their findings.

 

Remember that “Covid vaccine changes our genome” was considered an antiscience antivax trope and was constantly ridiculed by Pfizer-sponsored press. [Blog Editor Bold Text Emphasis – My interpretation: MSM does what its told to do even if harmful to the general public.]

 

Big Pharma Propaganda Spread by MSM

 

It turns out that the truth is more nuanced…

 

Now that tests of the genomic DNA of vaccinated subjects have confirmed these fears, will apologies be forthcoming?

 

© 2023 Igor Chudov

Igor’s Newsletter HOMEPAGE

SUBSCRIBE/SUPPORT Igor’s Newsletter

 

++++++++++++++++++++++++++

Bill Gates organization partners with biotech company to develop needle-free mRNA vaccine WAFER for taking under the tongue

Gates Smiling Holding Vial & Syringe (screengrab from Telegram)

 

Natural News Telegram

December 24, 2023 8:45am

 

In the coming soon dystopian future, patients will be able to take vaccines in wafer form under the tongue like some kind of abominable Eucharist rather than getting the usual needle injections, thanks in part to a new investment tied to billionaire eugenicist Bill Gates.

 

The Coalition for Epidemic Preparedness Innovations (CEPI), which works with the Bill & Melinda Gates Foundation, has partnered with a company called Jurata Thin Film, Inc. (Jurata) to develop a thermostable mRNA (modRNA) vaccine film that a doctor, behaving like a religious priest, will be able to place into the mouth of a patient as a rite of passage into "immunity."

 

Instead of patients having to continue rolling up their sleeve for a penetrating pharmaceutical injection, recipients of Jurata's product will simply need to open the mouth, lift up the tongue and receive the wafer-like film under their tongue for rapid dissolution.

 

"Vaccine distribution is just as important as vaccine development in response to an emerging crisis – so, while mRNA quickly became one of the technological 'shining stars' during the COVID-19 pandemic, global access to doses was majorly hindered by its frozen storage needs," said Ingrid Kromann, CEPI's acting director of vaccine manufacturing and supply chain, in a December 5 news release.

 

Edible vaccines to lure back the "vaccine hesitant"

 

A $1.2 million cash injection from CEPI will allow Jurata to develop what it describes as a "3D structure of mRNA-containing lipid nanoparticle (LNP) vaccine materials," which are to be derived from a company called Quantoom Biosciences. These materials will then be developed into a thin thermostable film "that will alleviate frozen storage and transportation issues associated with traditional needle and syringe vaccines," to quote the Epoch Times.

 

"LNP's are the delivery system used to deliver mRNA and have properties that may cause clotting or trigger the immune system."

 

The same initial round of CEPI will allow for pre-clinical trials to determine whether or not these novel films can actually deliver stabilized mRNA vaccines effectively, or if they will simply be broken down by saliva and the digestive system into inert foreign, and likely toxic, materials. If successful, pre-clinical trials will lead to clinical trials, which will lead to edible vaccine wafers being unleashed into the public.

 

Since many are now considered to be "vaccine hesitant," meaning they want nothing to do with Big Pharma's chemical injections, researchers are working on needle-free concepts that they hope will lure people back into the vaccination fold by making vaccines edible and "fun."

 

According to the terms of Jurata's agreement with CEPI, the films will need to be stable at temperatures of two to eight degrees, 25 degrees and 40 degrees. The films will also need to be optimized using different buffers, pH, stabilizers, sugars, salts and various drying parameters.

 

"Jurata's proprietary thin films have the potential to transform the way in which we store, deliver and distribute mRNA vaccines, advancing CEPI's pandemic preparedness plan to accelerate the speed and scale of our response to future epidemics and pandemics, and heighten access to vaccine doses," Kromann further said.

 

Commenting on the project, Dr. Robert Malone, credited as a founder of mRNA technology, says edible vaccine wafers will probably not do what their backers claim they will do.

 

"Sublingual delivery is useful for some drugs but seems poorly matched to LNP mod mRNA technology," Dr. Malone says.

 

"Needle-free mucosal vaccines have been on the vaccine developer wishlist for decades, but the barriers to achieving such a capability are substantial. However, if paired with self-replicating RNA technology, it is possible that something could come of this."

 

Join and share 👉@NaturalNewsMedia

 

++++++++++++++++++++++

FRIGHTENING TRUTH: Airborne mRNA Vaccines Are Being Created That Can Be Delivered Straight Into the Lungs Without the Need for Injection:

Researchers have developed an airborne mRNA vaccine offering a vehicle by which to rapidly vaccinate the masses without their knowledge or consent.

 

[Posted] By LIONESS OF JUDAH MINISTRY

December 22, 2023

Exposing The Darkness

By The Exposé December 22, 2023

 

Researchers have developed an airborne mRNA vaccine offering a vehicle by which to rapidly vaccinate the masses without their knowledge or consent.

 

A team from Yale University has developed a new airborne method for delivering mRNA right to your lungs. The method has also been used to vaccinate mice intranasally, “opening the door for human testing in the near future.

 

While scientists may celebrate this invention as a convenient method to vaccinate large populations, skeptics raise obvious concerns about the potential misuse of an airborne vaccine, including the possibility of covert bioenhancements a concept that has previously been suggested in academic literature. (source).

 

Roman Balmakov of Facts Matter discusses the study in the video below:

 

Rumble VIDEO: RESEARCHERS CREATE AEROSOLIZED MRNA "VACCINE"

[Posted by nonvaxer420

Published September 7, 2023

 

MORE DESCRIPTION]

 

The Study: Polymer nanoparticles deliver mRNA to the lung for mucosal vaccination

 

In a research conducted on mice, scientists from Yale University developed polymer nanoparticles to encapsulate mRNA, transforming it into an inhalable form for delivery to the lungs. Courtney Malo, who serves as an editor at Science Translational Medicine, the publication that featured the study, explained,

 

The ability to efficiently deliver mRNA to the lung would have applications for vaccine development, gene therapy, and moreHere, Suberi et al. showed that such mRNA delivery can be accomplished by encapsulating mRNAs of interest within optimized poly(amine-co-ester) polyplexes [nanoparticles].

 

Polyplex-delivered mRNAs were efficiently translated into protein in the lungs of mice with limited evidence of toxicity. This platform was successfully applied as an intranasal SARS-CoV-2 vaccine, eliciting robust immune responses that conferred protection against subsequent viral challenge.

 

These results highlight the potential of this delivery system for vaccine applications and beyond.

 

The team, which was led by cellular and molecular physiologist Mark Saltzman, claims that the inhalable mRNA vaccine “successfully protected against “SARS-CoV-2“, and that it “opens the door to delivering other messenger RNA (mRNA) therapeutics for gene replacement therapy and other treatments in the lungs.”(source)

mRNA therapeutics for gene replacement therapy & other treatments in the lungs

 

For the study, mice received two intranasal doses of nanoparticles carrying mRNA COVID-19 vaccines, which proved to be effective in the animals. In the past, lung-targeted mRNA therapies had trouble making it into the cells necessary to express the encoded protein, known as poor transfection efficiency (source).

 

“The Saltzman group got around this hurdle in part by using a nanoparticle made from poly(amine-co-ester) polyplexes, or PACE, a biocompatible and highly customizable polymer,” a Yale University news release explained. In a previous study, Saltzman had tried a “prime and spike” system to deliver COVID-19 shots, which involved injecting mRNA shots into a muscle, then spraying spike proteins into the nose.

 

It turned out the injection portion may be unnecessary, and Saltzman has high hopes for the airborne delivery method, beyond vaccines: (source).

 

“In the new report, there is no intramuscular injection. We just gave two doses, a prime, and a boost, intranasally, and we got a highly protective immune response. But we also showed that, generally, you can deliver different kinds of mRNA. So it’s not just good for a vaccine, but potentially also good for gene replacement therapy in diseases like cystic fibrosis and gene editing.

 

We used a vaccine example to show that it works, but it opens the door to doing all these other kinds of interventions.”

 

Air Vax Could ‘Radically Change’ How People Are Vaccinated


Saltzman says this “new method of delivery could ‘radically change the way people are vaccinated,’” making it easier to vaccinate people in remote areas or those who are afraid of needles.10 But that’s not all. An airborne vaccine makes it possible to rapidly disseminate it across a population.

 

No Jab Needed

 

By releasing the vaccine in the air, there’s no need to inject each person individually — which is not only time-consuming but difficult if an individual objects to the shot. This isn’t the case with an airborne vaccine, which can be released into the air without consent or even the public’s knowledge.

 

A similar strategy is being used with mRNA in shrimp, which are too small and numerous to be injected individually. Instead, an oral “nanovaccine” was created to stop the spread of a virus. Shai Ufaz, chief executive officer of ViAqua, which developed the technology, stated:

 

Oral delivery is the holy grail of aquaculture health development due to both the impossibility of vaccinating individual shrimp and its ability to substantially bring down the operational costs of disease management while improving outcomes …”

 

While the Yale scientists are targeting an intranasal mRNA product, the outcome is the same — get as many exposed as possible with the least amount of cost and effort. According to the Yale study:

 

An inhalable platform for messenger RNA (mRNA) therapeutics would enable minimally invasive and lung-targeted delivery for a host of pulmonary diseases. Development of lung-targeted mRNA therapeutics has been limited by poor transfection efficiency and risk of vehicle-induced pathology.

 

Here, we report an inhalable polymer-based vehicle for the delivery of therapeutic mRNAs to the lung. We optimized biodegradable poly(amine-co-ester) (PACE) polyplexes [nanoparticles] for mRNA delivery using end-group modifications and polyethylene glycol. These polyplexes achieved high transfection of mRNA throughout the lung, particularly in epithelial and antigen-presenting cells.

 

We applied this technology to develop a mucosal vaccine for severe acute respiratory syndrome coronavirus 2 and found that intranasal vaccination with spike protein–encoding mRNA polyplexes induced potent cellular and humoral adaptive immunity and protected susceptible mice from lethal viral challenge. Together, these results demonstrate the translational potential of PACE polyplexes for therapeutic delivery of mRNA to the lungs.”

 

The following excerpts are from Dr Joseph Mercola, who explains his concerns regarding the airborne mRNA

US Government Has History of Bioweapons Release

 

When you put the pieces of the puzzle together, a disturbing picture emerges. As reported by The Epoch Times, we have a history of the U.S. government taking extreme measures to mandate and promote COVID-19 shots to the public. Now, researchers have developed an airborne mRNA vaccine, offering a vehicle by which to rapidly vaccinate the masses without their knowledge or consent (source).

 

Is there proof that the government or another entity has plans to covertly release an air vax on the population? No. But there is a history of it carrying out secret bioweapon simulations on Americans. In 1950, the U.S. Navy sprayed Serratia marcescens bacteria into the air near San Francisco over a period of six days.

 

Dubbed “Operation Sea Spray,” the project was intended to determine how susceptible the city was to a bioweapon attack. Serratia marcescens turns whatever it touches bright red, making it easy to track. It spread throughout the city, as residents inhaled the microbes from the air. While the U.S. military initially thought Serratia marcescens wouldn’t harm humans, an outbreak occurred, with some developing urinary tract infections as a result.

 

At least one person died “and some have suggested that the release forever changed the area’s microbial ecology,” Smithsonian Magazine reported. This wasn’t an isolated incident, as the U.S. government carried out many other experiments across the U.S. over the next 20 years. (source).

 

 So, while it’s disturbing to think of an air vax experiment being conducted on an unsuspecting public, it’s not unprecedented.


Bioethics Study Promotes Covert, Compulsory Bioenhancement


Adding to the story is academic endorsement of the use of compulsory, covert bioenhancements. Writing in the journal Bioethics, Parker Crutchfield with Western Michigan University, Homer Stryker M.D. School of Medicine, discusses moral bioenhancements, which refers to the use of biomedical means to trigger moral improvements.

 

Drug treatments, including vaccines, and genetic engineering are potential examples of bioenhancements. Further, according to Crutchfield:

 

“It is necessary to morally bioenhance the population in order to prevent ultimate harm. Moral bioenhancement is the potential practice of influencing a person’s moral behavior by way of biological intervention upon their moral attitudes, motivations, or dispositions.

 

The technology that may permit moral bioenhancement is on the scale between nonexistent and nascent, but common examples of potential interventions include infusing water supplies with pharmaceuticals that enhance empathy or altruism or otherwise intervening on a person’s emotions or motivations, in an attempt to influence the person’s moral behavior.”

 

Some argue that moral bioenhancements should be compulsory for the greater good. Crutchfield believes this doesn’t go far enough. He also wants them to be covert: (source).

 

“I take this argument one step further, arguing that if moral bioenhancement ought to be compulsory, then its administration ought to be covert rather than overt. This is to say that it is morally preferable for compulsory moral bioenhancement to be administered without the recipients knowing that they are receiving the enhancement.”

 

He even goes so far as to suggest “a covert compulsory program promotes values such as liberty, utility, equality and autonomy better than an overt program does.” (source).

 

So here we have evidence of academic support for covertly releasing drugs and other bioenhancements onto the public. This, combined with the creation of an airborne mRNA vaccine and the government’s history of experimenting on the public, paints an unsettling picture of the future.

 

Problems With mRNA COVID Shots Persist

 

Aside from the concerns of airborne delivery, mRNA COVID-19 shots are associated with significant risks — no matter how you’re exposed. People ages 65 and older who received Pfizer’s updated (bivalent) COVID-19 booster shot may be at increased risk of stroke, according to an announcement made by the U.S. Centers for Disease Control and Prevention and the Food and Drug Administration. (source).

 

Further, a large study from Israel revealed that Pfizer’s COVID-19 mRNA jab is associated with a threefold increased risk of myocarditis, leading to the condition at a rate of 1 to 5 events per 100,000 persons (source). Other elevated risks were also identified following the COVID jab, including lymphadenopathy (swollen lymph nodes), appendicitis, and herpes zoster infection (source).

 

At least 16,183 people also say they’ve developed tinnitus after receiving a COVID-19 shot (source). The reports were filed with the CDC’s Vaccine Adverse Event Reporting System (VAERS) database. But considering only between 1% and 10% of adverse reactions are ever reported to VAERS, the actual number is likely much higher.

 

It’s because of risks like these that informed consent is essential for any medical procedure, including vaccinations. The development of airborne mRNA jabs, however, makes the possibility of informed consent being taken away all the more real. From Mercola

 

© 2023 Lioness of Judah

Exposing The Darkness HOMEPAGE

SUBSCRIBE/SUPPORT Exposing The Darkness

 

++++++++++++++++++++++++++

Dr Robert Malone: ‘I’ve Been Labelled an Enemy of the State for Speaking Inconvenient Truths’ | British Thought Leaders

 

British Thought Leaders

Dec-21-2023

 

[Blog Editor: To watch on EPOCH TV, you may need a paid subscription so I uploaded to my Bitchute Channel. In the case of the possibility of The Epoch Times sending a copyright complaint to Bitchute, I also posted on my UGETube Channel.]

 

Bitchute VIDEO: DR ROBERT MALONE- ‘I’VE BEEN LABELLED AN ENEMY OF THE STATE FOR SPEAKING INCONVENIENT TRUTHS’

[Posted by SlantRight2

First Published December 23rd, 2023 16:51 UTC

 

MORE DESCRIPTION]

 

NTD’s Lee Hall sits down with Dr. Robert Malone to talk about vaccines, a global surge in mortality rates, and the consequences of our pandemic policies.

 

Dr. Malone discusses the weaponisation of language, a global psyops campaign to suppress dissent, and the capture of mainstream media.

 

Copyright © 2000 - 2023 The Epoch Times Association Inc. All Rights Reserved.

EPOCH TV HOMEPAGE

The Epoch Times HOMEPAGE

ABOUT EPOCH TV


Monday, February 28, 2022

Actual Science of mRNA Deaths & DNA Alterations

 


John R. Houk, Blog Editor

© February 28, 2022

 

I am not actually a science-oriented person. HOWEVER, I can read. Today I am sharing info from science oriented people. If you can refute the data with a science rebuttal that is not a simple fake Globalist-science admonition of “fake,” “false” – without the reason, “misinformation” by telling why without character assassination, and YOU GET THE IDEA; then I’d love to read the scientific refutation. If you cannot, I’ll just call you a Left-Wing lying propagandist trying to maintain Globalist-Marxist control of the population via fearmongering.

 

The first cross post is explanatory from the title: “Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years.”

 

The next two cross posts are related to the science-deep reporting of Igor Chudov on Substack. Those posts are full of links and diagrams to actual scientific studies that stretches my mind to comprehend but Chudov makes the effort to make the science comprehensible.

 

FIRST Chudov article: I’m using the NWO Report version because it’s simply easier to read than the Substack version was posted on 2/25/22: “Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA.”

 

SECOND Chudov article: Is from his Substack page: “DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene.”

 

JRH 2/28/22

I need your generosity. PLEASE GIVE to overcome research expenses:

Please Support SlantRight 2.0

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**************************

Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years

 

By Brian Shilhavy Editor, Health Impact News

February 26, 2022

Vaccine Impact

 

 

Comparison VAERS Vaxx Data

 

The latest data dump into the U.S. Government’s Vaccine Adverse Events Reporting System (VAERS) happened yesterday (2/25/21) and covers data through 2/18/2022.

 

This data is supplied by the FDA and the CDC.

 

Since December of 2020, when the COVID-19 vaccines were issued emergency use authorization, there are now a recorded 1,134,984 cases of deaths and injuries.

 

 

1-Year-Data-Covid19-Vaccines

Source.

 

There are now more reported cases of injuries and deaths following COVID-19 vaccines for the past year than there were following all vaccines for the previous 30 years before the COVID-19 vaccines were authorized.

 

 

30+ Years Data Cases VAERS

Source.

 

And there are now almost twice as many deaths recorded following COVID-19 vaccines in its first year than there were recorded in the previous 30 years before the COVID-19 vaccines were introduced.

 

Why are we still doing this?

 

Here is the CDC’s response after publishing this data:

 

CDC (DECEPTIVE) response to Data

 

Comment on this article at HealthImpactNews.com.

See Also:

 

Rumble VIDEO: In Memoriam: Victims of COVID-19 "Vaccines"

[Posted by HealthImpactNews

Published August 2, 2021

 

There are no second chances after you take the shot(s) and your family and friends mourn you at your funeral.]

 

MORE Information on Page TO READ

 

Copyright 2022 Health Impact News 

Vaccine Impact HOME PAGE

 

+++++++++++++++++++++

Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA

 

 

Pfizer Jab

 

Posted by Nwo Report

Source: Igor Chudov

February 27, 2022

NWO Report

 

For over a year, our trusted “health experts and fact checkers” have been telling us that mRNA vaccines, including Pfizer and Moderna, do not integrate themselves into human cellular DNA. However, a bombshell new study published in Current Issues of Molecular Biology shows that the health experts and fact checkers were wrong.

 

Lab studies show that mRNA vaccines DO integrate themselves into human cellular DNA. In essence, the vaccines change your DNA forever.

 

 

Intracellular Reverse Transcription Pfizer

 

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

 

Mainstream media and fact checkers have dedicated themselves to telling us the opposite:

 

MSM Disinformation Lies

 

However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.

 

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

 

 

IgorChudov reports:

 

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

 

However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

 

Molecular Biology Abstract screen capture

 

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.

 

It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).

 

What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.

 

This process is called “transcription”.

 

For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.

 

To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.

 

Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

 

 

Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme

 

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

 

 

Transcribed DNA Seen NOT RNA

 

The genetic code that they picked up is:

 

Ø CGAGGTGGCCAAGAATCTGAACGAGA

 

Ø GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA

 

Ø TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT

 

Ø GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT

 

Ø TCGACGAGGACGATTCTGAGCCCGTGCTGA

 

Ø AGGGCGTGAAACTGCACTACACATGATGAC

 

Ø TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA

 

Ø GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT

 

Ø CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

 

Anyone wants to run BLAST on it?

 

Simplified

 

As I explained in response to a questioner:

 

Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.

 

Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.

 

Cancer Code

 

Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.

 

Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.

 

Please repost this article far and wide due to its big implication for our public health.

 

EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?

 

 

mRNA and S Protein data

 

© 2022 NWO REPORT

 

++++++++++++++++++++

DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene

Having fun BLASTing DNA Reverse Transcribed from Pfizer Vax

 

By Igor Chudov

2/27/22

Igor’s Newsletter

 

My previous post about a science article proving that Pfizer mRNA vaccine reverse transcribes into human DNA, has garnered enormous interest and lots of comments, may of which were incredible.

 

If you did not read it yet, PLEASE READ IT FIRST before reading this article. Otherwise you may get lost and not even realize the significance of how your loved ones’ genetic code may have been reprogrammed. Here you go:

 

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?utm_source=substack&utm_campaign=post_embed&utm_medium=web

 

I decided to continue plodding along and see what else we can uncover, based on that “Current Issues in Molecular Biology” article:

 

 

Igor Newsletter- Reverse Transcription

 

The article contains a printout of genetic DNA code that was detected in human cell DNA materials reverse transcribed from the mRNA vaccine.

 

 

printout of genetic DNA code 

 

So, I decided to check what is actually in this code above, is that just harmless junk or something more ominous. For that, I ran a free NCBI “BLAST” tool by copying and pasting the above genetic sequence in it. This is the same BLAST tool that @JikkyKjj used to show a Moderna “cancer patent” sequence on the most important, “furin cleavage site” of Sars-Cov-2. I wrote about that also:

 

https://igorchudov.substack.com/p/moderna-patented-cancer-gene-is-in?utm_source=substack&utm_campaign=post_embed&utm_medium=web

 

Anyway, impressed with @JikkyKjj’s discovery, I decided to do the same with the DNA code that Pfizer mRNA vaccine generates (reverse transcribes) into human cells. Turns out that I was the first to enter that sequence into the NCBI BLAST tool (because it took a while to analyze) and it now has a sequence ID of 1R3ZDZJY016.

 

And here are the results. I annotated them to make it easier for you to see what is and is not interesting.

 

 

Igor Annotations

 

The first few results are from the usual suspects such as chimeric viruses, Sars-Cov-2 sequences, etc. It is understandable why we should ignore them — the chimeric viruses are pure lab constructs of unknown significance, and Sars-Cov-2 sequences are obviously there because the vaccine encodes Sars-Cov-2 spike protein. Those are “expected matches”.

 

What is interesting — and I am not saying it is the only thing — is the gp130 glycoprotein gene that is 97% similar to the human gp130 glycoprotein gene. The chance of that being a random coincidence, per BLAST tool, is 0.000000000000000000000000000000000000000000000000000000000002.

 

I clicked on it:

 

 

Red Dots Show gp130 Mutations

 

You can click on the “Gene” link to see what that gp130 gene is about:

 

 

TLE family member 5

 

 

here this gene is used

 

So, we have Pfizer Covid mRNA vaccine reverse transcribe to a MUTATED gp130 gene. Remember the 97% match? The 3% non-matches, the four red dots, are the mutations of the gp130 gene.

 

So, without looking at these specific mutations, what happens when gp130 gene mutates in general? Nothing good comes up and you can search for it too.

 

 

Liver Cancer focus

 

Please note that a question arises: gp130 mutations can cause liver tumor, and the entire experiment was performed on a line of immortal liver cancer cells. Could it be that the original article picked up mutated gp130 from the Huh7 liver cancer cells? If that is the case, if the DNA sequence is inherent to Huh7 line itself, it could invalidate a lot of conclusions that the original science article, as well as my own articles, were making.

 

However, the authors were diligent with controls and did NOT see the questioned DNA sequence that I am looking at, in the control cells that did NOT receive the Pfizer vaccine. In addition, the published DNA sequence contained Sars-Cov-2 genes (see BLAST results), so it does come from the effect of the vaccine, not the Huh7 culture cells.

 

No DNA in Controls

 

I did perform some cursory checks, to the best of my ability, and the Huh7 line contains p53 mutations, but it does not seem like it contains gp130 mutations.

 

So, keeping my fingers crossed, the mutated gp130 gene that I found, is a genuine finding of lab research, comes from the mRNA vaccine, and not a coincidental pickup from the Huh7 cells.

 

I am guessing that the authors were looking at liver cells specifically, because they knew where to look (that the mRNA delivery system delivers the lipid nanoparticles to the liver). Why did the authors pick liver cells? Maybe because they heard of this 4chan post from 2020, when NOTHING yet was known about the strange mRNA vaccines:

 

mRNA Mostly Ends Up in Liver

 

[Blog Editor: I’ve noticed Nwo Report authors have spliced some of the photo arrays from this point in their post above. If you choose to read it at the Igor Newsletter Substack go HERE.]

 

© 2022 Igor Chudov