DONATE

Monday, February 28, 2022

Actual Science of mRNA Deaths & DNA Alterations

 


John R. Houk, Blog Editor

© February 28, 2022

 

I am not actually a science-oriented person. HOWEVER, I can read. Today I am sharing info from science oriented people. If you can refute the data with a science rebuttal that is not a simple fake Globalist-science admonition of “fake,” “false” – without the reason, “misinformation” by telling why without character assassination, and YOU GET THE IDEA; then I’d love to read the scientific refutation. If you cannot, I’ll just call you a Left-Wing lying propagandist trying to maintain Globalist-Marxist control of the population via fearmongering.

 

The first cross post is explanatory from the title: “Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years.”

 

The next two cross posts are related to the science-deep reporting of Igor Chudov on Substack. Those posts are full of links and diagrams to actual scientific studies that stretches my mind to comprehend but Chudov makes the effort to make the science comprehensible.

 

FIRST Chudov article: I’m using the NWO Report version because it’s simply easier to read than the Substack version was posted on 2/25/22: “Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA.”

 

SECOND Chudov article: Is from his Substack page: “DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene.”

 

JRH 2/28/22

I need your generosity. PLEASE GIVE to overcome research expenses:

Please Support SlantRight 2.0

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**************************

Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years

 

By Brian Shilhavy Editor, Health Impact News

February 26, 2022

Vaccine Impact

 

 

Comparison VAERS Vaxx Data

 

The latest data dump into the U.S. Government’s Vaccine Adverse Events Reporting System (VAERS) happened yesterday (2/25/21) and covers data through 2/18/2022.

 

This data is supplied by the FDA and the CDC.

 

Since December of 2020, when the COVID-19 vaccines were issued emergency use authorization, there are now a recorded 1,134,984 cases of deaths and injuries.

 

 

1-Year-Data-Covid19-Vaccines

Source.

 

There are now more reported cases of injuries and deaths following COVID-19 vaccines for the past year than there were following all vaccines for the previous 30 years before the COVID-19 vaccines were authorized.

 

 

30+ Years Data Cases VAERS

Source.

 

And there are now almost twice as many deaths recorded following COVID-19 vaccines in its first year than there were recorded in the previous 30 years before the COVID-19 vaccines were introduced.

 

Why are we still doing this?

 

Here is the CDC’s response after publishing this data:

 

CDC (DECEPTIVE) response to Data

 

Comment on this article at HealthImpactNews.com.

See Also:

 

Rumble VIDEO: In Memoriam: Victims of COVID-19 "Vaccines"

[Posted by HealthImpactNews

Published August 2, 2021

 

There are no second chances after you take the shot(s) and your family and friends mourn you at your funeral.]

 

… MORE Information on Page TO READ

 

Copyright 2022 Health Impact News 

Vaccine Impact HOME PAGE

 

+++++++++++++++++++++

Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA

 

 

Pfizer Jab

 

Posted by Nwo Report

Source: Igor Chudov

February 27, 2022

NWO Report

 

For over a year, our trusted “health experts and fact checkers” have been telling us that mRNA vaccines, including Pfizer and Moderna, do not integrate themselves into human cellular DNA. However, a bombshell new study published in Current Issues of Molecular Biology shows that the health experts and fact checkers were wrong.

 

Lab studies show that mRNA vaccines DO integrate themselves into human cellular DNA. In essence, the vaccines change your DNA forever.

 

 

Intracellular Reverse Transcription Pfizer

 

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

 

Mainstream media and fact checkers have dedicated themselves to telling us the opposite:

 

MSM Disinformation Lies

 

However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.

 

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

 

 

IgorChudov reports:

 

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

 

However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

 

Molecular Biology Abstract screen capture

 

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.

 

It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).

 

What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.

 

This process is called “transcription”.

 

For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.

 

To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.

 

Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

 

 

Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme

 

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

 

 

Transcribed DNA Seen NOT RNA

 

The genetic code that they picked up is:

 

Ø CGAGGTGGCCAAGAATCTGAACGAGA

 

Ø GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA

 

Ø TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT

 

Ø GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT

 

Ø TCGACGAGGACGATTCTGAGCCCGTGCTGA

 

Ø AGGGCGTGAAACTGCACTACACATGATGAC

 

Ø TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA

 

Ø GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT

 

Ø CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

 

Anyone wants to run BLAST on it?

 

Simplified

 

As I explained in response to a questioner:

 

Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.

 

Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.

 

Cancer Code

 

Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.

 

Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.

 

Please repost this article far and wide due to its big implication for our public health.

 

EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?

 

 

mRNA and S Protein data

 

© 2022 NWO REPORT

 

++++++++++++++++++++

DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene

Having fun BLASTing DNA Reverse Transcribed from Pfizer Vax

 

By Igor Chudov

2/27/22

Igor’s Newsletter

 

My previous post about a science article proving that Pfizer mRNA vaccine reverse transcribes into human DNA, has garnered enormous interest and lots of comments, may of which were incredible.

 

If you did not read it yet, PLEASE READ IT FIRST before reading this article. Otherwise you may get lost and not even realize the significance of how your loved ones’ genetic code may have been reprogrammed. Here you go:

 

https://igorchudov.substack.com/p/worst-fears-realized-pfizer-mrna?utm_source=substack&utm_campaign=post_embed&utm_medium=web

 

I decided to continue plodding along and see what else we can uncover, based on that “Current Issues in Molecular Biology” article:

 

 

Igor Newsletter- Reverse Transcription

 

The article contains a printout of genetic DNA code that was detected in human cell DNA materials reverse transcribed from the mRNA vaccine.

 

 

printout of genetic DNA code 

 

So, I decided to check what is actually in this code above, is that just harmless junk or something more ominous. For that, I ran a free NCBI “BLAST” tool by copying and pasting the above genetic sequence in it. This is the same BLAST tool that @JikkyKjj used to show a Moderna “cancer patent” sequence on the most important, “furin cleavage site” of Sars-Cov-2. I wrote about that also:

 

https://igorchudov.substack.com/p/moderna-patented-cancer-gene-is-in?utm_source=substack&utm_campaign=post_embed&utm_medium=web

 

Anyway, impressed with @JikkyKjj’s discovery, I decided to do the same with the DNA code that Pfizer mRNA vaccine generates (reverse transcribes) into human cells. Turns out that I was the first to enter that sequence into the NCBI BLAST tool (because it took a while to analyze) and it now has a sequence ID of 1R3ZDZJY016.

 

And here are the results. I annotated them to make it easier for you to see what is and is not interesting.

 

 

Igor Annotations

 

The first few results are from the usual suspects such as chimeric viruses, Sars-Cov-2 sequences, etc. It is understandable why we should ignore them — the chimeric viruses are pure lab constructs of unknown significance, and Sars-Cov-2 sequences are obviously there because the vaccine encodes Sars-Cov-2 spike protein. Those are “expected matches”.

 

What is interesting — and I am not saying it is the only thing — is the gp130 glycoprotein gene that is 97% similar to the human gp130 glycoprotein gene. The chance of that being a random coincidence, per BLAST tool, is 0.000000000000000000000000000000000000000000000000000000000002.

 

I clicked on it:

 

 

Red Dots Show gp130 Mutations

 

You can click on the “Gene” link to see what that gp130 gene is about:

 

 

TLE family member 5

 

 

here this gene is used

 

So, we have Pfizer Covid mRNA vaccine reverse transcribe to a MUTATED gp130 gene. Remember the 97% match? The 3% non-matches, the four red dots, are the mutations of the gp130 gene.

 

So, without looking at these specific mutations, what happens when gp130 gene mutates in general? Nothing good comes up and you can search for it too.

 

 

Liver Cancer focus

 

Please note that a question arises: gp130 mutations can cause liver tumor, and the entire experiment was performed on a line of immortal liver cancer cells. Could it be that the original article picked up mutated gp130 from the Huh7 liver cancer cells? If that is the case, if the DNA sequence is inherent to Huh7 line itself, it could invalidate a lot of conclusions that the original science article, as well as my own articles, were making.

 

However, the authors were diligent with controls and did NOT see the questioned DNA sequence that I am looking at, in the control cells that did NOT receive the Pfizer vaccine. In addition, the published DNA sequence contained Sars-Cov-2 genes (see BLAST results), so it does come from the effect of the vaccine, not the Huh7 culture cells.

 

No DNA in Controls

 

I did perform some cursory checks, to the best of my ability, and the Huh7 line contains p53 mutations, but it does not seem like it contains gp130 mutations.

 

So, keeping my fingers crossed, the mutated gp130 gene that I found, is a genuine finding of lab research, comes from the mRNA vaccine, and not a coincidental pickup from the Huh7 cells.

 

I am guessing that the authors were looking at liver cells specifically, because they knew where to look (that the mRNA delivery system delivers the lipid nanoparticles to the liver). Why did the authors pick liver cells? Maybe because they heard of this 4chan post from 2020, when NOTHING yet was known about the strange mRNA vaccines:

 

mRNA Mostly Ends Up in Liver

 

[Blog Editor: I’ve noticed Nwo Report authors have spliced some of the photo arrays from this point in their post above. If you choose to read it at the Igor Newsletter Substack go HERE.]

 

© 2022 Igor Chudov


Sunday, February 27, 2022

Russia's Invasion of Ukraine

 


Whoops readers! Justin Smith submitted a post on 2/23/22 about Russia’s invasion of the Ukraine. I missed it. Justin suggested I post it for archive purposes since some of the info therein is dated as of today 2/27/22. So here is that post with minimal editing and lots of info even though a bit late.

 

JRH 2/27/22

I need your generosity. PLEASE GIVE to overcome research expenses:

Please Support SlantRight 2.0

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

***************************

Russia's Invasion of Ukraine

Putin Longs for the Former Russian Empire - Ukrainians Haven't Forgotten History

 

By Justin O. Smith

Sent February 23, 2022 10:03 AM

"If we have to fight them, now is the time. From now on we will get weaker and they stronger."  ~ General George S. Patton, May 20th 1945 [Justin located: “Snow and Steel: The Battle of the Bulge, 1944-45 (JRH) - Punctuation Marks of History (JOS);” Erenow]

 

 The world is witnessing Joe Biden and his regime resign themselves to reacting rather than take hard, firm action to stop Russia's invasion of Ukraine, as ordered by President Vladimir Putin on February 21st 2022, who is now pushing on and doing just as he wishes in total disregard for the Budapest Memorandum of 1994, the Minsk Agreement of 2015, European norms and thirty years of diplomacy agreed to by Russia, Europe and America. Putin is moving assuredly with confidence to take Ukraine and rebuild the Russian Empire, and a cheap imitation of a "president" pretending to take a strong position is the last thing America and the world need at the helm, as the next few weeks will determine the status of freedom in the world for the rest of the century.

 

Under different leadership and one that full well recognizes the global stakes at hand,  this crisis might actually have a favorable resolution for America and Europe, quite possibly even Russia. But as it stands at this juncture in history, Putin seeks to initially use Ukraine to destroy Europe's and the world's faith in America's willingness to lead the Free World; and at this moment, most of America doesn't believe Joe Biden is up to the challenge, or even capable of handling it in a way that doesn't have severe long term consequences for America. 

 

On February 22nd 2022, Joe Biden addressed the American people, in part, stating:

 

"This is the beginning of a Russian invasion of Ukraine. I'm going to begin to impose sanctions in response, far beyond the steps we and our allies and partners imposed in 2014. If Russia goes further with this invasion we stand prepared to go further." 

 

Ironic isn't it? Here this pretender to the Oval Office stands yammering about defending Ukraine, when he violates U.S. immigration law and won't even defend America's borders.

 

The degree of seriousness with which Biden is viewing this is anyone's guess. In the back of his mind certainly must be concerns of damaging information in Burisma Holdings Ltd documents being released, regarding his and son Hunter's corrupt dealings in Ukraine's energy programs. While over on the Russian side of the equation, Hillary Clinton doesn't want the real story of her involvement in ROSTROM [Russia's energy company] coming to the forefront again.

 

One of the few things Biden got right was when he said that "(Putin's) setting up a rationale to go much further."

 

Despite contentions from some journalists on Fox News that this is just another manufactured crisis to deflect from Biden failures, nothing could be further from the truth. Anyone who has kept up with the timeline on Putin's actions in the region over the past decade, full well understands this. 

 

Yes -- the dynamics of this story have more twists and turns than an Agatha Christie novel. 

 

Anyone who has watched the fall of the old Soviet Union and Putin's rise to power with all it's troubling aspects now are wishing our leaders of long ago had let General Patton drive his tanks all the way into Moscow's Red Square. Although Putin may not exactly long for Russia's communist past, his actions from the 2014 subversion and incursion into Ukraine and the annexation of Crimea, in conjunction with his most recent speech on February 21st 2022, perfectly illustrate his main intent is in fact to see the Russian empire reconstituted as it was before 1922, as he appeared to be enraged and not completely in control of his emotions at times, revealing just how serious a situation the world now faces.

 

Putin blamed everyone for Russia's current state of decline, from the old rulers to the Soviet Union to Europe and America. He also bemoaned the loss of the "territory of the former Russian empire."

 

I try not to indulge in predicting anything, but in this case, the available facts suggest to me that Putin will not be content to just recognize the independence of Donetsk and Luhansk, two Ukrainian breakaway, republics, and signing "friendship treaties". His gambit of "diplomacy" was merely a delaying action he utilized, as he deployed Russian armed forces and supplies and built pontoon bridges and field hospitals just four miles from the Ukraine border, and the 200,000 Russian soldiers amassed are enough for a full-scale invasion; and given his moves in the Black Sea and the recent successful test of a hypersonic missile, one can only conclude that Putin intends to conquer all Ukraine, in order to seize the world's breadbasket and all its rich resources. 

 

Regardless of the desperation of Europe's leaders and the Biden regime to find a glimmer of hope for any real solution that leaves Ukraine whole, sovereign and free, the fact remains that Putin has already violated two major treaties with the West, i.e. the Budapest Memorandum and Minsk Agreement, and to think that any sanctions will stop Putin from completing his agenda is enough to make one laugh raucously out loud. Putin has been preparing for at least the last seven years, after taking Crimea, and he has more than likely set back a good bit of Russia's oil money for just such a moment. And just today, per Putin's request, the Duma gave Putin "permission" to deploy Russian armed forces abroad. 

 

And one cannot help but wonder just how hard Europe will fight to keep Ukraine free, when they have become so overly dependent on Russian gas and oil, with some sixty-percent of its energy coming from Russia by some accounts. However, Eurocrat suggests forty percent of EU gas comes from Russia, with the EU providing over sixty percent of Russia's import revenues. Europe never learned the lesson from 2009, when Russia froze Europe by suspending gas shipments. 

 

Too little, too late, the EU representative for foreign affairs, Josep Borrell, recently wrote:

 

"With the severe crisis that we are currently going through with Russia, it has become not only a price issue but also a matter of security of supplies. However, in recent years, Russia has enhanced its resilience against economic sanctions, by increasing its foreign currency reserves, more than we have done to enhance our capacity to face potential gas supply cuts."

 

All of this becomes more ironic, once we recall that under President Trump, America had become a major exporter of oil and natural gas, and part of his energy plan included selling quality gas to Europe at a great price that would enable them to gradually remove themselves from dependence on Russian energy. But now, Biden has destroyed all those gains and has the U.S. going hat-in-hand and begging for more oil from those who hate America. Roll the laugh track, with pictures of Marine La Pen and Margaret Thatcher in tears and Angela Merkel smiling a smile that would make a shark shudder.

 

On the other hand, Viktor Orban has shown sympathy for Putin's position, and as a result, Hungary's energy costs are three times lower than the rest of the EU. Hungary gets eighty percent of its gas from Gazprom, Russia's main supplier of gas to Europe. 

 

In this context, Germany's decertification and rejection of the Nord Stream 2 Pipeline has no bearing on anything, since gas hadn't even begun to flow through it. This is so much worthless lip service and less than nothing in the opening salvos of this war.

 

Speaking to Fox News recently, retired U.S. Army Lt. Gen. Keith Kellogg, suggested:

 

"Right now, I'd tell the president if I was advising the president, we're done talking and you tell Putin, you play your cards, we're going to play our cards and play hard. You know, Putin appreciates strength and we're not portraying strength at all. This whole idea about, well, let's talk again, let's talk again, I think it absolutely folly. It's not going to work. He's got his game plan in mind, and we should go forward with ours."

 

What makes the entire situation ever more complicated and dire is the knowledge that for the most part the Europeans have grown fat, stupid, lazy and weak where their own defense mechanisms are concerned, having grown far too willing to let America bear the brunt of the cost for Europe's defense in money and the blood of our young men and women, and these simply are people without the capacity to risk any manner of war with Russia, or even a rough few moments of real conflict, in order to align themselves with America's response, whatever form it takes. The fact remains, the trouble is breaking out in their backyard and it is the people of Ukraine and Eastern Europe and Europe proper who will suffer the ultimate fallout, but regardless of whether they hate or love Russia and Putin, their lack of will to stop his aggression puts their own liberty, sovereignty and lives at risk over the long haul. 

 

Equally alarming is the forgotten cost of this war, that is already sending food prices climbing, since Russia and Ukraine combined account for twenty-nine percent of the worldwide wheat export market and Ukraine was the top corn exporter to China in 2021. Take this in conjunction with the extremely important raw materials necessary for many industries that primarily come from Ukraine and Russia currently, and a great economic turndown could result, if this does turn into a full blown invasion and a war that will be fought in a new hybrid-style of war that will even use debilitating and deadly cyber attacks on all countries involved. 

 

And then there's the fact that Biden as Commander-in-Chief and General Mark "Woke-Ass" Milley and the current crop of weak U.S. Commanders -- who rose to the top during Obama's purge of the military -- don't exactly instill hope, promise and confidence in the American people or the people of Europe, especially after watching America allow politics to lead to a virtual defeat in Afghanistan. Many man hours have been taken away from actual combat training to pursue identity politics and issues centered on race, ethnicity, sexual orientation. One can't help but wonder just exactly how much time has been taken away from missile systems training and the rifle range to pursue transgender sensitivity training. 

 

On February 21st 2022, Ingrida Simonyte, the Prime Minister of Lithuania, stated in a tweet on her official account:

 

"Putin just put Kafka & Orwell to shame: no limits to dictator's imagination, no lows too low, no lies too blatant, no red lines too red to cross. What we witnessed tonight might seem surreal for democratic world. But the way we respond will define us for the generations to come."

 

Biden is playing from behind as he has ordered troops into Lithuania, Latvia, Estonia, Germany, Poland and Hungary in a manner that should have been executed tenfold over starting soon after Russia's November 2021 troop buildup along Ukraine's border became readily apparent. Along with this, the U.S. should have immediately sent nuclear weapons into Poland, even though some suggest this would serve as a provocation for Putin.

 

At some point, the West must show its own resolve to not allow one more piece of land to be taken by an invasion perpetrated by an evil, tyrannical dictator bent on the restoration of the old Russian Empire and acquiring untold amounts of new power. Or do we simply sit back and watch a rerun of the years that led to WWII, with the same sort of appeasement and the same gross jack-booted tramplings and murders of innocent people simply yearning to be free?

 

A homegrown Ukrainian resistance and guerrilla warfare may be Ukraine's final hope to eventually send Putin's forces back whence they came, although Russia is medieval, vicious and ruthless in its handling of counterinsurgency operations because it has proven to be effective. Just as Russian forces terrorized the people of Chechnya and Syria, we can look for the same in Ukraine. Putin stated in his speech that he had the names of anti-Russian elements in Odessa, who would be found and punished, which corroborated assertions made by U.N. Ambassador Crocker. This is reminiscent of Moscow's same tyrannical operations in Poland, the Baltic states and the many regions of Europe it occupied over the last century.

 

Recently, Ambassador Bathsheba Nell Crocker sent an alarming letter to Michelle Bachelet, the U.N. High Commissioner for Human Rights, that suggested a Russian plans to do more harm to the people of Ukraine in the aftermath of the invasion, writing:

 

"... information recently obtained by the United States ... indicates that human rights violations and abuses ... are being planned. These acts, which in past Russian operations have included targeted killings, kidnappings/forced disappearances, unjust detentions, and the use of torture, would likely target those who oppose Russian actions, including Russian and Belarusian dissidents in exile in Ukraine, journalists and anti-corruption activists, and vulnerable populations such as religious and ethnic minorities and LGBTQI+ persons. Specifically, we have credible information that indicates Russian forces are creating lists of identified Ukrainians to be killed or sent to camps following a military occupation."

 

Panic in the populace hasn't set in yet, although there have been several days of continuous shelling on the edges of Ukraine. The stores still have goods to sell and grocery stores still have food, and the children still play their games without a care, as though their country isn't on the edge of the ever growing abyss of a full-scale war, while the adults deal with the dark clouds of their anxiety and fear.

 

Biden's weakness and his own affirmation that he wouldn't send U.S. troops and air support to Ukraine is the factor that emboldened Putin, as Biden continues to react to Putin rather than leading from a position of strength that makes Putin stop and retreat to his own borders. Putin has been left with the impression that he can take all of Ukraine with little to no real world consequences, and for the moment, he is right.

 

The results and consequences of Putin's Eastern Europe Gambit remain to be seen and fully realized, and it may be yet that Putin has miscalculated. He has his own economic troubles -- deteriorating demographics, Russian society's proclivity for corruption and a country too dependent on energy to boost its GDP-- that are currently being concealed by Russia's renewed sense of national pride. Putin's Russia might ultimately prove to be a Potemkin superpower, and Ukraine might be Putin's Afghanistan.

 

In the meantime, Poland, Estonia, Lithuania and Latvia stand to be in the next line of Russian aggressions, should Russia actually complete a full conquest of Ukraine. And that busts the gate wide open for the taking of much of the rest of Europe too.

 

America is left holding all its own failures, that combined with the European Union's shocking failures to create this current crisis with Russia and their defeat in the post-Cold War era looming over them like the Angel of Death. The complacency of the Free World and the helter-skelter psychosis of immorality that the decadent West embraced was enabled by the sense of relief, calm and confidence that manifested with the Soviet Union's collapse in 1989. And along the way, America turned inward upon itself, with a deep chasm that had grown between its two competing and antithetical ideologies, as half the nation began an extremely dangerous assault on the founding principles and virtues that built America and made Her so exceptional, and somewhere over the course of the past three decades, we set ourselves up to lose the post-Cold War era to those proponents of evil who would destroy freedom and liberty for all. 

 

Ukraine may already be lost. If this does prove to be the case, it should hasten numerous strategic moves by what is left of "the Free World" to stop Putin from taking one more aggressive step towards any portion of Europe -- those frontline states, and all the Western allies must come together more resolved and unified than ever. This is their wake-up call to fully and effectively close specific military vulnerabilities and capability gaps, as they increase their presence in personnel and armaments and build NATO-style multinational battalions all along the Eastern Front. 

 

Whatever Putin may think, rightly or not, Ukraine absolutely has the absolute right to be free from Russian tyranny and subjugation, a goal it has worked towards in a generations long fight to be free of Russian encroachments and occupation for over one thousand years, despite Putin's historical revisionism that attempts to convince the world Ukraine never was a state. State or not, the Ukrainian people have always seen themselves as separate from Russia -- the same Russia that murdered 10 million Ukrainians in the genocide of 1932-1933 to stop their independence movement. Ukrainians haven't forgotten.

 

By Justin O. Smith

__________________________

Edited by John R. Houk

Embedded source links are By Justin Smith.

 

© Justin O. Smith


Saturday, February 26, 2022

Gog-Magog in Prophecy – Toss in CCP & Globalist Control Salad

 


John R. Houk, Blog Editor

February 26, 2022

 

If any Christian has read End Times Biblical Scripture and/or Christian End Times literature, a lot what is happening in relation to the Ukraine/Russia War and CCP saber rattling about militarily annexing Taiwan via Communist aggression has to have their spiritual radar beeping.

 

AND SO, here are some Christian related cross posts that might be of interest.

 

JRH 2/26/22

I need your generosity. PLEASE GIVE to overcome expenses:

Please Support SlantRight 2.0

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**************************

Russia’s war on Ukraine: Are we living in the End Times?

 

By Anugrah Kumar, Christian Post Contributor

Date from email alert: 2/26/22

The Christian Post

 

Pastor Greg Laurie speaking at SoCal Harvest in Anaheim, California, on Aug. 23, 2019. | Courtesy of Harvest

 

Is Russia’s war on Ukraine a significant event in terms of prophecies recorded in the Bible? As many Christians debate this question, Southern California Pastor Greg Laurie explains why he believes we are living in the End Times.

 

“This is war at a scale we have not seen in a long time,” Laurie, senior pastor and founder of the multi-campus Harvest Christian Fellowship in California, says in a video message **[Blog Editor: I am posting the Youtube version of the message along with description text below this post] posted on his church’s website, referring to Matthew 24:6, which reads, “And you will hear of wars and rumors of wars.”

 

The following verse, he adds, talks about plagues being around us in the last days. “If the coronavirus is not a plague, I don’t know what it is. It’s a global plague.”

 

Many Bible scholars believe that the mention of Magog attacking Israel in Ezekiel 38 is modern-day Russia, he continues.

 

According to another prophecy in Ezekiel, Jewish people will be scattered and regathered in their land again, which has been fulfilled, Laurie continues, explaining that during World War II and after the Holocaust, Jewish people from around the world began to return to their land. And Israel officially became a nation on May 14, 1948.”

 

But Scripture also says that a nation from the extreme north of Israel, called Gog and Magog, will march on her, he says, adding that Ukraine used to be a part of the Russian Empire until 1991.

 

“If you look on any map, you’ll see that is the geographical area of Russia. Are they going to be part of Russia again? Could be. But the one thing that I think of is that when I see the aggression of Russia or Magog, if you will, it’s a reminder that that’s what we’re going to see when Magog attacks Israel.”

 

And if we believe that the prophecies are coming true, “we should look up, and we should remember that God is in control,” Laurie concludes.

 

Joel Rosenberg, an American-Israeli communications strategist, author and nonprofit executive, also wrote a few years ago that: “The Hebrew prophet Ezekiel wrote 2,500 years ago that in the ‘last days of history, Russia and Iran will form a military alliance to attack Israel from the north. Bible scholars refer to this eschatological conflict, described in Ezekiel 38–39, as the ‘War of Gog & Magog.’”

 

He quotes Ezekiel 38:14-16, which reads: “Therefore, son of man, prophesy and say to Gog: ‘This is what the Sovereign Lord says: In that day, when my people Israel are living in safety, will you not take notice of it? You will come from your place in the far north, you and many nations with you, all of them riding on horses, a great horde, a mighty army. You will advance against my people Israel like a cloud that covers the land. In days to come, Gog, I will bring you against my land, so that the nations may know me when I am proved holy through you before their eyes.”

 

The Christian apologist website Got Questions also talks about Russia in biblical prophecy.

 

“Gog is a person. Whoever Gog is, he is from the land of Magog and is the leader of Tubal and Meshek (some translations add ‘Rosh’ to the list) and a confederacy of other nations: Persia, Cush, Put, Gomer, and Beth Togarmah (Ezekiel 38:5–6). And, whoever he is, he will have plans to ‘attack a peaceful and unsuspecting people,’ viz., Israel (verses 11, 14, and 18). But, regardless of Gog’s plans, the Lord God is against him and will defeat him soundly (Ezekiel 38:4, 19–23; 39:3–5).”

 

“Persia,” a nation listed as being in alliance with Magog, is modern-day Iran.

 

  © 2022 The Christian Post, INC. All Rights Reserved.

 

+++++++++++++++++++++++

Youtube VIDEO: Ukraine and Bible Prophecy (With Greg Laurie)


 
Posted by Pastor Greg Laurie

Posted Feb 25, 2022

 

We’re all aware of what’s happening over in the Ukraine right now. They’re under attack from Russia, and people have asked the question, “Is there any significance to all of this prophetically?” Let me pull the camera back and say this: I believe we’re living in the last days. I believe Christ could come back at any moment.

 

There are signs of the times the Bible tells us to be looking for. And in fact, Jesus likened it to labor pains in a woman who’s ready to give birth, the idea being the closer they get together, the closer you are to the birth. And as we see more signs—more things happening—they’re reminding us Christ is coming back again. Let’s go to Matthew 24.

 

What did Jesus say? “And you will hear of wars and rumors of wars” (Matthew 24:6 NKJV). So this is war at a scale we have not seen in a long time. But let me look at another thing in Matthew 24. It talks about plagues being around us in the last days (Matthew 24:7). If the coronavirus is not a plague, I don’t know what it is. It’s a global plague.

 

Also, I would add that the Bible warns of a world leader that will come and dominate and deceive people but ultimately reveal his true colors. And he’s called the Antichrist. I believe a lot of this government overreach, imposing themselves on their people, is a sign of what is going to come later when Antichrist emerges on the scene.

 

Russia in Bible Prophecy

 

But let’s come to the situation in the Ukraine. Many Bible scholars believe in the Ezekiel 38, as it speaks of Magog attacking Israel, that that is modern day Russia. I could go and talk about that for, you know, 30 minutes, why they believe that’s true. I happen to agree with them, but it says in Ezekiel that the Jewish people will be scattered and regathered in their land again.

 

We know, during World War II and after the Holocaust, Jewish people from around the planet began to return to their land. And Israel officially became a nation on May 14, 1948. So that part of their prophecy has been fulfilled. But then scripture says a nation from the extreme north of Israel will march on her called Gog and Magog.

 

If you look on any map, you’ll see that is the geographical area of Russia. Ukraine used to be a part of the Russian Empire. They broke off in 1991. Are they going to be part of Russia again? Could be. But the one thing that I think of is that when I see the aggression of Russia or Magog, if you will, it’s a reminder that that’s what we’re going to see when Magog attacks Israel.

 

What Should We Do?

 

So Jesus said, “When you see these things begin to happen, freak out!”

 

No, he didn’t say that. He said, “Now when these things begin to happen, look up and lift up your heads, because your redemption draws near” (Luke 21:28 NKJV). Here’s the bottom line and takeaway truth: Bible prophecies are being fulfilled in our lifetime. It seems like we’re seeing more things happen in real time, closer together, as the Scripture said they would be.

 

What should we do? We should look up, and we should remember that God is in control. And we’ve read the last page of the Bible, the last page of Revelation, and we win in the end.

 

Let me also add this: Let’s all be praying for the people of the Ukraine. They’re going through a time of great suffering right now. Pray for them. Pray that God gives to our leaders wisdom as they’re making very important decisions in the days ahead.

 

… READ MORE for Church, devotional and support info

 

++++++++++++++++++++++

Rumble VIDEO: Prophecy Update: The New World Order… Epicenter, Canada!

Posted by Prophecy Update Videos

Published February 24, 2022

 

…

 

Pastor Tom Hughes

If you'd like to support our ministry, please visit: http://b.link/support-us

 

…

 

All the signs of the last days are converging at the same time. Bible Prophecy is happening right before our eyes and like birth pains, the predicted events are happening more frequently and more intently. Never, in the history throughout the world have so many forces, including economic, scientific, techno-logic, ecologic, cultural, geopolitical, moral, spiritual and religion, converged together to bring this world that's already teetering over the edge into the abyss, to a point of no return. Jesus said when you see all these signs happening, know that I am near, even at the door.

 

For more in-depth studies, commentary, and analysis of Bible Prophecy and End Times events visit our web site www.prophecyupdate.com and sign-up for our free newsletter… READ ENTIRETY

 

++++++++++++++++++++

In Times like These be Extra Watchful

 

 

Xi & Putin Pals (FourSignPosts [Alexey Druzhinin- Sputnik-AFP-Getty] photo)

 

By MARK DAVIDSON 

FEBRUARY 24, 2022 

THE FOUR SIGNPOSTS

 

I wrote not too long ago in this post that things are looking more and more like there is a three-way trap leading the world into the Second Signpost. One of the three is the situation with Ukraine.

 

So now Russia invaded Ukraine this morning.

 

Hopefully, it will be limited to Russia militarily defending the two break-away areas in the Donbas region and will be over. And hopefully, the US administration won’t be dumb enough to indirectly encourage China to move against Taiwan. I wouldn’t bet on either though.

 

Now is one of those times to especially be alert, to be watching and praying.

With the developments this morning, Senator Lindsey Graham (R-SC) made a statement that was parallel to this seeming three-way trap of the Second Signpost, though of course he didn’t put it that way.

 

I have come to believe that when the Second Signpost occurs it will be because the US military is tied down by Iran’s allies, China and Russia. Daniel 8:4 (NASB) says of the charge of the Persian ram:

 

“. . . nor was there anyone to rescue from his power.”

 

In other words, the US forces will be already defeated or pulled out of the area due to global circumstances. China’s CCP will be expanding its power and influence for Taiwan is only the first step to taking over the entire East Earth. And the IRGC will be charging out and occupying Mideast Muslim countries. This is summed up succinctly when Senator Graham said, “You’ll be in a third world war and you’ll have a bunch of radical Islamists with nuclear weapons.” That does sum it up and sets the stage for the unfolding of the remainder of the Signposts.

 

Furthermore, in this hemisphere, it looks like the West, which has made the love of money their god, will lose it due to any number of circumstances. Pertaining to this, Senator Graham also said, “I don’t know how much more we have to suffer as a nation and let bad guys kick us in the a– and lose control of our own destiny here at home.”

 

Well, that may very well be our destiny for we have forgotten our God as a nation, and He may very well let us lose everything so will come back to Him.

 

As Keller wrote in his book Counterfeit Gods, “People don’t realize Jesus is all you need until Jesus is all you have.”

 

We may not have very much time. That’s a problem when one is watching. It looks like the coming event could be years away and other times it looks hours away—like now.

 

Just be ready. Dwell in his shelter. Cast out the idols of your heart and make Him your only God.

 

Copyright © Mark Davidson, all rights reserved. All materials on Foursignposts.com may be freely reproduced and distributed for teaching and study purposes, provided proper credit is given. Materials may not be sold or included in any product that is sold unless granted special permission.