John R. Houk, Blog Editor
© February 28, 2022
I am not actually a science-oriented person. HOWEVER, I can
read. Today I am sharing info from science oriented people. If you can refute
the data with a science rebuttal that is not a simple fake Globalist-science
admonition of “fake,” “false” – without the reason, “misinformation” by telling
why without character assassination, and YOU GET THE IDEA; then I’d love to
read the scientific refutation. If you cannot, I’ll just call you a Left-Wing
lying propagandist trying to maintain Globalist-Marxist control of the
population via fearmongering.
The first cross post is explanatory from the title: “Official
Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as
Deaths Following All Vaccines for the Previous 30 Years.”
The next two cross posts are related to the science-deep
reporting of Igor
Chudov on Substack. Those posts are full of links and
diagrams to actual scientific studies that stretches my mind to comprehend but
Chudov makes the effort to make the science comprehensible.
FIRST Chudov article: I’m using the NWO Report version because it’s simply
easier to read than the Substack
version was posted on 2/25/22: “Bombshell
New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA.”
SECOND Chudov article: Is from his Substack page: “DNA
Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene.”
JRH 2/28/22
I need your generosity. PLEASE GIVE to overcome research expenses:
Big Tech Censorship is pervasive – Share voluminously on
all social media platforms!
**************************
Official Government Data: Twice as Many Deaths Following
COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous
30 Years
By Brian Shilhavy Editor, Health Impact News
February 26, 2022
The latest data dump into the U.S. Government’s Vaccine
Adverse Events Reporting System (VAERS) happened yesterday (2/25/21)
and covers data through 2/18/2022.
This data is supplied by the FDA and the CDC.
Since December of 2020, when the COVID-19 vaccines were
issued emergency use authorization, there are now a recorded 1,134,984 cases of
deaths and injuries.
There are now more reported cases of injuries and deaths
following COVID-19 vaccines for the past year than there were following all
vaccines for the previous 30 years before the COVID-19 vaccines were
authorized.
And there are now almost twice as many deaths recorded
following COVID-19 vaccines in its first year than there were recorded in the
previous 30 years before the COVID-19 vaccines were introduced.
Why are we still doing this?
Here is the CDC’s response after publishing this data:
CDC
(DECEPTIVE) response to Data
Comment on this article at HealthImpactNews.com.
See Also:
Rumble VIDEO: In
Memoriam: Victims of COVID-19 "Vaccines"
[Posted by HealthImpactNews
Published August 2, 2021
There are no second chances after
you take the shot(s) and your family and friends mourn you at your funeral.]
… MORE
Information on Page TO READ
Copyright 2022 Health Impact
News
Vaccine Impact HOME PAGE
+++++++++++++++++++++
Bombshell New Study Proves Pfizer mRNA Vaccine
Permanently Alters Human DNA
Posted by Nwo
Report
Source: Igor
Chudov
February 27, 2022
For over a year, our trusted “health experts and fact
checkers” have been telling us that mRNA vaccines, including Pfizer and Moderna,
do not integrate themselves into human cellular DNA. However, a bombshell new
study published in Current Issues of Molecular Biology shows
that the health experts and fact checkers were wrong.
Lab studies show that mRNA vaccines DO integrate themselves
into human cellular DNA. In essence, the vaccines change your DNA forever.
Intracellular
Reverse Transcription Pfizer
What it is saying is: lab studies show that mRNA
vaccine DOES integrate itself into human cellular DNA. This means that a
shot of Pfizer vaccine, taken even once, permanently changes the DNA of
affected cells.
Mainstream media and fact checkers have dedicated themselves
to telling us the opposite:
However, the bombshell article from Current
Issues of Molecular Biology suggests they have been spreading
disinformation all along.
A new study is out: Intracellular Reverse
Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in
Human Liver Cell Line.
IgorChudov reports:
What it is saying is: lab studies show that mRNA
vaccine DOES integrate itself into human cellular DNA. This means that a
shot of Pfizer vaccine, taken even once, permanently changes the DNA of
affected cells.
However, the bombshell article from
Current Issues of Molecular Biology shows the opposite.
Molecular
Biology Abstract screen capture
What the article shows is that in vitro, using a human liver
cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme
called LINE-1, and the genetic code of the vaccine is reverse
transcribed into the DNA.
It also explains that vaccine mRNA actually does travel to
the liver as one of the preferred sites (the other sites, as we heard, are
ovaries and more).
What does it mean? Normally, our cells do the opposite: the
cell nucleus, where the DNA is, expresses certain DNA code based on conditions
of the cell, and produces natural, human messenger RNA. That messenger RNA
travels out of the nucleus, where it is expressed into proteins needed for cell
building. This is how growing organisms express different genetic programs to
grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central
Dogma of Molecular Biology stated that the “reverse
transcription” — moving genetic code from RNA back into the sacred cellular
nucleus and recoding the DNA — was impossible. Eventually, scientists realized
that it is possible under various conditions. For example, the HIV RNA virus is
able to do so and it reprograms our DNA to produce copies of it. HIV is the
virus that causes AIDS.
To effect reverse transcription, enzymes called “reverse
transcriptases” are needed. One of them is called LINE-1.
Apparently, per study, the Pfizer mRNA vaccine causes cells
to produce that LINE-1 enzyme.
Pfizer
mRNA vaccine causes cells to produce that LINE-1 enzyme
After seeing LINE-1 reverse transcriptase rise, they tested
for alterations to the DNA, making sure they are not picking up the RNA
instead.
The genetic code that they picked up is:
Ø
CGAGGTGGCCAAGAATCTGAACGAGA
Ø
GCCTGATCGACCTGCAAGAACTGGGGAAGT
ACGAGCAGTACATCAAGTGGCCCTGGTACA
Ø
TCTGGCTGGGCTTTATCGCCGGACTGATTG
CCATCGTGATGGTCACAATCATGCTGTGTT
Ø
GCATGACCAGCTGCTGTAGCTGCCTGAAGG
GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
Ø
TCGACGAGGACGATTCTGAGCCCGTGCTGA
Ø
AGGGCGTGAAACTGCACTACACATGATGAC
Ø
TCGAGCTGGTACTGCATGCACGCAATGCTA
GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
Ø
GTCTCCCCCGACCTCGGGTCCCAGGTATGC
TCCCACCTCCACCTGCCCCACTCACCACCT
Ø
CTGCTAGTTCCAGACACCTCCCAAGCACGC
AGCAATGCAGCTCAAAACGCTTAGCCTA
Anyone wants to run BLAST on it?
Simplified
As I explained in response to a questioner:
Pfizer mRNA vaccine changes our
genetic code that determines how our organisms operate, that you inherited from
your mom and dad. Now your DNA was changed from what your mom and dad gave you,
by adding a little mysterious “edit” from Pfizer.
Your organism acts in accordance
with your DNA program, and now, well, the program has been hacked and modified
by Pfizer.
Cancer Code
Considering that Sars-Cov-2 “spike protein” has cancer code
from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications
of this reverse transcription, and whether the vaccinated now have any
undesirable genetic code embedded into their DNA.
Of particular interest is whether this mRNA-induced reverse
transcription affects the “germ line”, such as eggs and sperm cells, and
whether it also affects the fetus of pregnant mothers.
Please repost this article far and wide due to its big
implication for our public health.
EDIT: Our astute commenter pointed out an anonymous 4chan
post from Dec 2020, long before any of this became known. The date makes us all
ask, did this person know too much?
© 2022 NWO REPORT
++++++++++++++++++++
DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT
gp130 Tumor Gene
Having fun BLASTing DNA Reverse Transcribed from
Pfizer Vax
By Igor Chudov
2/27/22
My previous
post about a science article proving
that Pfizer mRNA vaccine reverse transcribes into human DNA, has garnered
enormous interest and lots of comments, may of which were incredible.
If you did not read it yet, PLEASE READ IT FIRST before
reading this article. Otherwise you may get lost and not even realize the
significance of how your loved ones’ genetic code may have been reprogrammed.
Here you go:
I decided to continue plodding along and see what
else we can uncover, based on that “Current Issues in Molecular
Biology” article:
Igor
Newsletter- Reverse Transcription
The article contains a printout of genetic DNA code that
was detected in human cell DNA materials reverse transcribed from the mRNA
vaccine.
So, I decided to check what is actually in this code above,
is that just harmless junk or something more ominous. For that, I ran a free NCBI “BLAST” tool by
copying and pasting the above genetic sequence in it. This is the same BLAST
tool that @JikkyKjj used to show a Moderna “cancer patent” sequence on the most
important, “furin cleavage site” of Sars-Cov-2. I wrote about that also:
Anyway, impressed with @JikkyKjj’s discovery, I
decided to do the same with the DNA code that Pfizer mRNA vaccine generates
(reverse transcribes) into human cells. Turns out that I was the first to enter
that sequence into the NCBI BLAST tool (because it took a while to analyze) and
it now has a sequence ID of 1R3ZDZJY016.
And here are the
results. I annotated them to make it easier for you to see what is
and is not interesting.
The first few results are from the usual suspects such as
chimeric viruses, Sars-Cov-2 sequences, etc. It is understandable why we should
ignore them — the chimeric viruses are pure lab constructs of unknown
significance, and Sars-Cov-2 sequences are obviously there because the vaccine
encodes Sars-Cov-2 spike protein. Those are “expected matches”.
What is interesting — and I am not saying it is the only
thing — is the gp130 glycoprotein gene that is 97% similar to the human
gp130 glycoprotein gene. The chance of that being a random coincidence, per
BLAST tool, is 0.000000000000000000000000000000000000000000000000000000000002.
I clicked on it:
You can click on the “Gene”
link to see what that gp130 gene is about:
So, we have Pfizer Covid mRNA vaccine reverse transcribe to
a MUTATED gp130 gene. Remember the 97% match? The 3% non-matches, the
four red dots, are the mutations of the gp130 gene.
So, without looking at these specific mutations, what
happens when gp130 gene mutates in general? Nothing good comes up and you can
search for it too.
Please note that a question arises: gp130 mutations can
cause liver tumor, and the entire experiment was performed on a line of
immortal liver cancer cells. Could it be that the original article
picked up mutated gp130 from the Huh7 liver cancer cells? If that is the
case, if the DNA sequence is inherent to Huh7 line itself, it could invalidate
a lot of conclusions that the original science article, as well as my own
articles, were making.
However, the authors were diligent with controls and did NOT
see the questioned DNA sequence that I am looking at, in the control cells that
did NOT receive the Pfizer vaccine. In addition, the published DNA sequence
contained Sars-Cov-2 genes (see BLAST results), so it does come from the effect
of the vaccine, not the Huh7 culture cells.
I did perform some cursory checks, to the best of my
ability, and the Huh7 line contains p53 mutations, but it does not seem like it
contains gp130 mutations.
So, keeping my fingers crossed, the mutated gp130 gene that
I found, is a genuine finding of lab research, comes from the mRNA vaccine, and
not a coincidental pickup from the Huh7 cells.
I am guessing that the authors were looking at liver cells
specifically, because they knew where to look (that the mRNA delivery system
delivers the lipid nanoparticles to the liver). Why did the authors pick liver
cells? Maybe because they heard of this 4chan post from 2020, when NOTHING yet
was known about the strange mRNA vaccines:
[Blog Editor: I’ve noticed Nwo Report authors have
spliced some of the photo arrays from this point in their post above. If you
choose to read it at the Igor Newsletter Substack go HERE.]
© 2022 Igor Chudov
No comments:
Post a Comment